Top » Catalog » J2 » P279

$18.00

P279
[P279]

P279
hg38 Position: ChrY:3013336..3013336
Ancestral: G
Derived: A
Reference: Karafet et al. (2007)
ISOGG Haplogroup: J2a2a
Comments: P279
Forward Primer: P279_F GGCAGGACAACTGAGAGCAG
Reverse Primer: P279_R AGAGATGGGGGTTTCACTG
Reviews

Customers who bought this product also purchased
PF7381
PF7381
M12
M12
Z6049
Z6049
MF10470
MF10470
Z38506
Z38506
CTS7683
CTS7683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies