Top » Catalog » J2 » P279

$18.00

P279
[P279]

P279
hg38 Position: ChrY:3013336..3013336
Ancestral: G
Derived: A
Reference: Karafet et al. (2007)
ISOGG Haplogroup: J2a2a
Comments: P279
Forward Primer: P279_F GGCAGGACAACTGAGAGCAG
Reverse Primer: P279_R AGAGATGGGGGTTTCACTG
Reviews

Customers who bought this product also purchased
PF5050
PF5050
SK1403
SK1403
M410
M410
PF5048
PF5048
CTS7683
CTS7683
PF5060
PF5060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21091
1 x FGC17782
1 x Y14569
1 x FGC35458
1 x BY32808
1 x Y7694
1 x HU206
1 x FGC20419
1 x A19101
1 x A23313
1 x A19151
1 x FGC35491
$216.00
Haplogroup Info
Other products
Currencies