Top » Catalog » J2 » PF5048

$18.00

PF5048
[PF5048]

PF5048
hg38 Position: ChrY:19696523..19696523
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5048_F AAAAATTTCTATACTATCCCGAGAGG
Reverse Primer: PF5048_R ACTTTAAAAGTCTTTAATCCATGTTCC
Reviews

Customers who bought this product also purchased
BY114993
BY114993
Z38506
Z38506
Y164257
Y164257
J2-M172 Superclade Panel
J2-M172 Superclade Panel
PF5056
PF5056
PF5050
PF5050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7447
1 x A9989
1 x Y12540
1 x BY11402
$72.00
Haplogroup Info
Other products
Currencies