Top » Catalog » J2 » PF5048

$18.00

PF5048
[PF5048]

PF5048
hg38 Position: ChrY:19696523..19696523
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5048_F AAAAATTTCTATACTATCCCGAGAGG
Reverse Primer: PF5048_R ACTTTAAAAGTCTTTAATCCATGTTCC
Reviews

Customers who bought this product also purchased
Y164257
Y164257
BY114993
BY114993
Z38506
Z38506
M410
M410
PF5060
PF5060
CTS7683
CTS7683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
$324.00
Haplogroup Info
Other products
Currencies