Top » Catalog » J2 » PH4306

$18.00

PH4306
[PH4306]

PH4306
hg38 Position: ChrY:17068950..17068950
Ancestral: T
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: PH4306_F GGAACAGGAGTGTCAAACAGG
Reverse Primer: PH4306_R TTACCTGGATGGTCAATGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
1 x Y13668
1 x S11868
$162.00
Haplogroup Info
Other products
Currencies