Top » Catalog » J2 » PH4306

$18.00

PH4306
[PH4306]

PH4306
hg38 Position: ChrY:17068950..17068950
Ancestral: T
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: PH4306_F GGAACAGGAGTGTCAAACAGG
Reverse Primer: PH4306_R TTACCTGGATGGTCAATGAAG
Reviews

Customers who bought this product also purchased
M205
M205
J2b-M12 Panel
J2b-M12 Panel
Y22063
Y22063
Y22082
Y22082
Y22079
Y22079
YP13
YP13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies