Top » Catalog » J2 » S25269

$18.00

S25269
[S25269]

S25269
hg38 Position: ChrY:21023278..21023278
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: S25269_F GTTGGGAATTTGGCCAATAAG
Reverse Primer: S25269_R GACCTCCTCACTGCTGAGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15073
1 x A12472
1 x Y12600
1 x Y15202
1 x PH890
1 x CTS7683
1 x Y16930
1 x HU214
1 x A16337
1 x HU224
1 x Y7704
1 x FGC6745
1 x MF10488
1 x Y18824
1 x Y22466
1 x Y14364
1 x MF10508
1 x Y18397
1 x L558
$342.00
Haplogroup Info
Other products
Currencies