Top » Catalog » J2 » S25269

$18.00

S25269
[S25269]

S25269
hg38 Position: ChrY:21023278..21023278
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: S25269_F GTTGGGAATTTGGCCAATAAG
Reverse Primer: S25269_R GACCTCCTCACTGCTGAGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies