Top » Catalog » J2 » SK1366

$18.00

SK1366
[SK1366]

SK1366
hg38 Position: ChrY:7829588..7829588
Ancestral: T
Derived: G
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a3a
Comments: Equal or downstream L26
Forward Primer: SK1366_F ATGTGGCCTGTCCATCTTTC
Reverse Primer: SK1366_R TGGATGCTCACCACCTACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BZ770
1 x Z40586
$36.00
Haplogroup Info
Other products
Currencies