Top » Catalog » J2 » SK1366

$18.00

SK1366
[SK1366]

SK1366
hg38 Position: ChrY:7829588..7829588
Ancestral: T
Derived: G
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a3a
Comments: Equal or downstream L26
Forward Primer: SK1366_F ATGTGGCCTGTCCATCTTTC
Reverse Primer: SK1366_R TGGATGCTCACCACCTACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15895
1 x Y20053
1 x Y13343
1 x PF7372
1 x A12380
1 x A24025
1 x A19150
1 x FGC35464
1 x A22122
1 x A16362
1 x PF7381
1 x FGC4993
1 x Y15234
1 x PF4908
1 x L317
1 x A516
1 x FGC5934
1 x SK1344
1 x FGC45341
1 x A19118
1 x L398
1 x HU223
1 x FGC6724
1 x PF5316
1 x BY45499
1 x PF7395
1 x Y3629
1 x Y12623
1 x Y16945
1 x FGC5900
$540.00
Haplogroup Info
Other products
Currencies