Top » Catalog » J2 » SK1390

$18.00

SK1390
[SK1390]

SK1390
hg38 Position: ChrY:14061671..14061671
Ancestral: C
Derived: T
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a10*
Comments: Equal or downstream PF5216
Forward Primer: SK1390_F GGATTTTCTTTAAGGCAGCGG
Reverse Primer: SK1390_R GTCTCTGAATTCCTAGTGCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
$36.00
Haplogroup Info
Other products
Currencies