Top » Catalog » J2 » Y12602

$18.00

Y12602
[Y12602]

Y12602
hg38 Position: ChrY:12760791..12760791
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y12602_F TGGGGAATCAACTTTGTTTTG
Reverse Primer: Y12602_R AAGCAGATGCTGCAATGAAC
Reviews

Customers who bought this product also purchased
Z6049
Z6049
SK1317
SK1317
M172
M172
Y12378
Y12378
PF5050
PF5050
SK1321
SK1321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
$126.00
Haplogroup Info
Other products
Currencies