Top » Catalog » J2 » Y12602

$18.00

Y12602
[Y12602]

Y12602
hg38 Position: ChrY:12760791..12760791
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y12602_F TGGGGAATCAACTTTGTTTTG
Reverse Primer: Y12602_R AAGCAGATGCTGCAATGAAC
Reviews

Customers who bought this product also purchased
CTS4371
CTS4371
Y12618
Y12618
Y16576
Y16576
Y51684
Y51684
Y140389
Y140389
Y27505
Y27505
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies