Top » Catalog » J2 » FGC35464

$18.00

FGC35464
[FGC35464]

FGC35464
hg38 Position: ChrY:7202549..7202549
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC35464_F ATGAATGCCCACGGACTAAG
Reverse Primer: FGC35464_R TGTGTTGGGCAATACCAATC
Reviews

Customers who bought this product also purchased
Z7700
Z7700
L70
L70
L25
L25
Z39099
Z39099
Z2227
Z2227
CTS6061
CTS6061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3197
1 x FGC17487
1 x A19606
1 x A11913
1 x CTS8428
1 x FGC4708
1 x BY13788
1 x BY6714
$144.00
Haplogroup Info
Other products
Currencies