Top » Catalog » J2 » FGC35464

$18.00

FGC35464
[FGC35464]

FGC35464
hg38 Position: ChrY:7202549..7202549
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC35464_F ATGAATGCCCACGGACTAAG
Reverse Primer: FGC35464_R TGTGTTGGGCAATACCAATC
Reviews

Customers who bought this product also purchased
L25
L25
Z39099
Z39099
Z2227
Z2227
CTS6061
CTS6061
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z435
Z435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HU209
$18.00
Haplogroup Info
Other products
Currencies