Top » Catalog » J2 » PF5183

$18.00

PF5183
[PF5183]

PF5183
hg38 Position: ChrY:13604443..13604443
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5183_F GCTGGCAACTGATTGTATGG
Reverse Primer: PF5183_R TTGCAAGGATCTGCACTAGC
Reviews

Customers who bought this product also purchased
L24
L24
S19231
S19231
M67
M67
PF5174
PF5174
L26
L26
PF5172
PF5172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies