Top » Catalog » J2 » PF7421

$18.00

PF7421
[PF7421]

PF7421
hg38 Position: ChrY:20910359..20910359
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7421_F GCGAAAACTACCGACTTTGG
Reverse Primer: PF7421_R CCAAGTCCCTGGGAATACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies