Top » Catalog » J2 » CTS10662

$18.00

CTS10662
[CTS10662]

CTS10662
hg38 Position: ChrY:20524603..20524603
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Syn. with CTS10662; downstream CTS333
Forward Primer: CTS10662_F TCAGACACTCACCCAGCATC
Reverse Primer: CTS10662_R TCCCCAGAAACCCCTAGAAG
Reviews

Customers who bought this product also purchased
Z2227
Z2227
PF5132
PF5132
Z6253
Z6253
PF5197
PF5197
M67
M67
M92
M92
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
1 x HU226
1 x Y7706
1 x CTS8204
1 x SK1354
1 x FGC45075
1 x FGC80314
1 x FGC32605
1 x FGC22233
1 x Y972
1 x Y12105
1 x Y961
1 x FGC5939
1 x FGC22276
1 x FGC16627
1 x FGC45777
$342.00
Haplogroup Info
Other products
Currencies