Top » Catalog » J2 » CTS10662

$18.00

CTS10662
[CTS10662]

CTS10662
hg38 Position: ChrY:20524603..20524603
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Syn. with CTS10662; downstream CTS333
Forward Primer: CTS10662_F TCAGACACTCACCCAGCATC
Reverse Primer: CTS10662_R TCCCCAGAAACCCCTAGAAG
Reviews

Customers who bought this product also purchased
Z7671
Z7671
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z6257
Z6257
M12
M12
Y4036
Y4036
FGC20157
FGC20157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies