Top » Catalog » J2 » CTS1969

$18.00

CTS1969
[CTS1969]

CTS1969
hg38 Position: ChrY:12015457..12015457
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of M205
Forward Primer: CTS1969_F TTCCTGGCCACTTTGCTTAC
Reverse Primer: CTS1969_R ATCTCACTGGGGCTTGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
$72.00
Haplogroup Info
Other products
Currencies