Top » Catalog » J2 » FGC5967

$18.00

FGC5967
[FGC5967]

FGC5967
hg38 Position: ChrY:19819358..19819358
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5967_F GTATGAATCCCCCAGTGCAG
Reverse Primer: FGC5967_R CTGTTGGCTGGAGAACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies