Top » Catalog » J2 » P81

$18.00

P81
[P81]

P81
hg38 Position: ChrY:6871815..6871815
Ancestral: G
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: J2a1g
Comments: AMELY AluY1
Forward Primer: P81_F TAGACCAAACGGGCATTTTG
Reverse Primer: P81_R GGCCCAGGACTCTATTTTCAC
Reviews

Customers who bought this product also purchased
Z2227
Z2227
L26
L26
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z39478
Z39478
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies