Top » Catalog » J2 » Y14678

$18.00

Y14678
[Y14678]

Y14678
hg38 Position: ChrY:14092596..14092596
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y14678_F CTCAAGAGGTACTCCTAACGTATCG
Reverse Primer: Y14678_R CCTAAAGAAAAGTAACTGCCAGTCC
Reviews

Customers who bought this product also purchased
Y8519
Y8519
L24
L24
S11868
S11868
Y28883
Y28883
L26
L26
Z6065
Z6065
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies