Top » Catalog » J2 » Y14678

$18.00

Y14678
[Y14678]

Y14678
hg38 Position: ChrY:14092596..14092596
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y14678_F CTCAAGAGGTACTCCTAACGTATCG
Reverse Primer: Y14678_R CCTAAAGAAAAGTAACTGCCAGTCC
Reviews

Customers who bought this product also purchased
Y28888
Y28888
Z2227
Z2227
Y7708
Y7708
Y8519
Y8519
L24
L24
S11868
S11868
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies