Top » Catalog » J2 » PF5316

$18.00

PF5316
[PF5316]

PF5316
hg38 Position: ChrY:15728722..15728722
Ancestral: T
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Approx. L24
Forward Primer: PF5316_F AATGGACCTGCAAACCTGTC
Reverse Primer: PF5316_R GGAGCACAGCTTGGTTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
1 x Y16913
1 x A16315
$234.00
Haplogroup Info
Other products
Currencies