Top » Catalog » J2 » PF5316

$18.00

PF5316
[PF5316]

PF5316
hg38 Position: ChrY:15728722..15728722
Ancestral: T
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Approx. L24
Forward Primer: PF5316_F AATGGACCTGCAAACCTGTC
Reverse Primer: PF5316_R GGAGCACAGCTTGGTTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies