Top » Catalog » J2 » Y19681

$18.00

Y19681
[Y19681]

Y19681
hg38 Position: ChrY:8942259..8942259
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2
Comments: Downstream of Y11782
Forward Primer: Y19681_F TCAGGAGAGTATTCACTGGTTCTG
Reverse Primer: Y19681_R GGTCATTAACCTAAGCAAAATAATGG
Reviews

Customers who bought this product also purchased
J2a-M67 Panel
J2a-M67 Panel
Y22280
Y22280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
$252.00
Haplogroup Info
Other products
Currencies