Top » Catalog » J2 » FGC16081

$18.00

FGC16081
[FGC16081]

FGC16081
hg38 Position: ChrY:13060123..13060123
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16081_F TGAATTTGGGTAGACAGTTCTGC
Reverse Primer: FGC16081_R CCATTTCACATGCAAAGACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
1 x HU226
1 x Y7706
1 x CTS8204
1 x SK1354
1 x FGC45075
1 x FGC80314
1 x FGC32605
1 x FGC22233
1 x Y972
1 x Y12105
1 x Y961
1 x FGC5939
1 x FGC22276
1 x FGC16627
$324.00
Haplogroup Info
Other products
Currencies