Top » Catalog » J2 » FGC16096

$18.00

FGC16096
[FGC16096]

FGC16096
hg38 Position: ChrY:14652234..14652234
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16096_F GAACAAAATGGCCTCTCGTG
Reverse Primer: FGC16096_R AAAAAGCTAAATTGAAATCGTCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies