Top » Catalog » J2 » FGC16096

$18.00

FGC16096
[FGC16096]

FGC16096
hg38 Position: ChrY:14652234..14652234
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16096_F GAACAAAATGGCCTCTCGTG
Reverse Primer: FGC16096_R AAAAAGCTAAATTGAAATCGTCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19114
1 x A11525
1 x Y14698
1 x FGC6756
1 x A18941
1 x BY32788
1 x L530
1 x Y17052
1 x Y17020
1 x S11348
1 x FGC21086
1 x CTS7515
1 x FGC21092
1 x A12377
1 x Y958
1 x Y14400
1 x Y9016
1 x M410
1 x F3369
1 x A16366
$360.00
Haplogroup Info
Other products
Currencies