Top » Catalog » J2 » FGC16152

$18.00

FGC16152
[FGC16152]

FGC16152
hg38 Position: ChrY:21408762..21408762
Ancestral: C
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16152_F CCACCAATTCTGGACACACC
Reverse Primer: FGC16152_R AAGGAAAACTTCGTCCTACCGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies