Top » Catalog » J2 » Y22280

$18.00

Y22280
[Y22280]

Y22280
hg38 Position: ChrY:7520804..7520807
Ancestral: ins
Derived: del
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: Y22280_F ACGTTGTATCCCATAAATGTATATCG
Reverse Primer: Y22280_R TATGATCATTTAAGTATATATACATATGTTTACAAG
Reviews

Customers who bought this product also purchased
Y19681
Y19681
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies