Top » Catalog » J2 » Y22056

$18.00

Y22056
[Y22056]

Y22056
hg38 Position: ChrY:15377820..15377820
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Approx. Z6057
Forward Primer: Y22056_F GAAATGCTAGGGCCCACG
Reverse Primer: Y22056_R CCTGCCTCATCAATTTGAGTG
Reviews

Customers who bought this product also purchased
M168
M168
Z2227
Z2227
M9
M9
M172
M172
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M438
M438
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies