Top » Catalog » J2 » Y22056

$18.00

Y22056
[Y22056]

Y22056
hg38 Position: ChrY:15377820..15377820
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Approx. Z6057
Forward Primer: Y22056_F GAAATGCTAGGGCCCACG
Reverse Primer: Y22056_R CCTGCCTCATCAATTTGAGTG
Reviews

Customers who bought this product also purchased
M9
M9
M172
M172
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M304
M304
Z6064
Z6064
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
1 x Y16913
1 x A16315
1 x SK1323
1 x Y23457
1 x SK1328
1 x Y22055
$306.00
Haplogroup Info
Other products
Currencies