Top » Catalog » J2 » Y23382

$18.00

Y23382
[Y23382]

Y23382
hg38 Position: ChrY:16137510..16137510
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Approx. Z6057
Forward Primer: Y23382_F GAAGGCAAAAGAATGAGTTTATGATG
Reverse Primer: Y23382_R GTATCCTGTCACTTTCCAATGTATTTC
Reviews

Customers who bought this product also purchased
J2a1-Y14434 Wiltshire, England Segregation Panel
J2a1-Y14434 Wiltshire, England Segregation Panel
Y22057
Y22057
Y14434
Y14434
SK1363
SK1363
Z6057
Z6057
L26
L26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2350
1 x A22591
1 x A15508
1 x Y19107
1 x A7138
$90.00
Haplogroup Info
Other products
Currencies