Top » Catalog » J2 » Y23382

$18.00

Y23382
[Y23382]

Y23382
hg38 Position: ChrY:16137510..16137510
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Approx. Z6057
Forward Primer: Y23382_F GAAGGCAAAAGAATGAGTTTATGATG
Reverse Primer: Y23382_R GTATCCTGTCACTTTCCAATGTATTTC
Reviews

Customers who bought this product also purchased
L26
L26
J2a1-Y14434 Wiltshire, England Segregation Panel
J2a1-Y14434 Wiltshire, England Segregation Panel
Y22057
Y22057
Y14434
Y14434
SK1363
SK1363
Z6057
Z6057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14434
1 x Y17408
1 x FGC30343
1 x PF5380
1 x FGC6738
1 x Y15169
1 x PF4275
1 x Y12622
1 x BY24003
1 x PF5294
1 x A19079
1 x FGC20254
1 x Y12594
1 x FGC32591
1 x M12
1 x A12503
1 x BY21723
1 x Y14701
1 x FGC9878
1 x PF5446
$360.00
Haplogroup Info
Other products
Currencies