Top » Catalog » J2 » Y7010

$18.00

Y7010
[Y7010]

Y7010
hg38 Position: ChrY:15037721..15037721
Ancestral: C
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: J2a1a (not listed)
Comments: .
Forward Primer: Y7010v2_F GTGACAGCCAACCAATTAAAGG
Reverse Primer: Y7010v2_R GCCCCCAAGATCCAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1393
$18.00
Haplogroup Info
Other products
Currencies