Top » Catalog » J2 » Y23094

$18.00

Y23094
[Y23094]

Y23094
hg38 Position: ChrY:13146213..13146213
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2b2a
Comments: Below L283
Forward Primer: Y23094_F GCTCCATAAGCTGAGATAACAGTACC
Reverse Primer: Y23094_R ACAAGTGTGAGCCACTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
1 x A24026
1 x A17922
1 x PH2967
1 x S15439
1 x SK1360
1 x S7835.2
$180.00
Haplogroup Info
Other products
Currencies