Top » Catalog » J2 » Y23162

$18.00

Y23162
[Y23162]

Y23162
hg38 Position: ChrY:12883223..12883223
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y23162_F TGTTCCCATTTATTTATGTCTGC
Reverse Primer: Y23162_R TTCAGCAAAGCAACACACAC
Reviews

Customers who bought this product also purchased
CTS900
CTS900
Y18397
Y18397
Z30685
Z30685
CTS6804
CTS6804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6747
1 x J2a-L24 Panel
1 x A15507
1 x A17934
1 x FGC20435
1 x Y16841
1 x Y13373
1 x FGC32480
1 x A23494
1 x BY25020
1 x CTS6804
1 x FGC32752
1 x FGC29947
1 x FGC30363
1 x FGC6759
1 x FGC32507
1 x Y16835
$376.00
Haplogroup Info
Other products
Currencies