Top » Catalog » J2 » FGC20430

$18.00

FGC20430
[FGC20430]

FGC20430
hg38 Position: ChrY:15532690..15532690
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2
Comments: Downstream of Y13097/FGC20417
Forward Primer: FGC20430_F ATGCACTGGCATGATCTGG
Reverse Primer: FGC20430_R CAATTTGAGACACAATCAACAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
$72.00
Haplogroup Info
Other products
Currencies