Top » Catalog » J2 » FGC20435

$18.00

FGC20435
[FGC20435]

FGC20435
hg38 Position: ChrY:16710208..16710208
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2
Comments: Downstream of Y13097/FGC20417
Forward Primer: FGC20435_F ATTTTAGAATGATAATCATTATTAACCTACCAG
Reverse Primer: FGC20435_R CCTATTTTACATCTATATAAGAAAGTTGCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7710
1 x SK1347
1 x Y13128
$54.00
Haplogroup Info
Other products
Currencies