Top » Catalog » J2 » FGC20443

$18.00

FGC20443
[FGC20443]

FGC20443
hg38 Position: ChrY:19906149..19906149
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2
Comments: Downstream of Y13097/FGC20417
Forward Primer: FGC20443_F CAAGCAGTTTTCCTATGTCAGC
Reverse Primer: FGC20443_R TGCAATGGAAGCAAAAATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
1 x A24026
1 x A17922
1 x PH2967
1 x S15439
1 x SK1360
1 x S7835.2
1 x A15071
1 x FGC32593
1 x Y12400
$234.00
Haplogroup Info
Other products
Currencies