Top » Catalog » J2 » FGC22233

$18.00

FGC22233
[FGC22233]

FGC22233
hg38 Position: ChrY:13394404..13394404
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2
Comments: Downstream of Y13373/FGC20419
Forward Primer: FGC22233_F GATCATGCCAAGAAAAACAATC
Reverse Primer: FGC22233_R GAAGGGCTGCAAAAAGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies