Top » Catalog » J2 » A12378

$18.00

A12378
[A12378]

A12378
hg38 Position: ChrY:11681821..11681821
Ancestral: C
Derived: T
Reference: Judith Simon (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12378_F TGGAATGGACCAGAATGC
Reverse Primer: A12378_R TGAATAAACGCCATTCGAGAC
Reviews

Customers who bought this product also purchased
A12380
A12380
A12379
A12379
A12377
A12377
A12376
A12376
A12375
A12375
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
1 x Y15239
1 x FGC16088
1 x Y12907
1 x Y1008
$198.00
Haplogroup Info
Other products
Currencies