Top » Catalog » J2 » A12380

$18.00

A12380
[A12380]

A12380
hg38 Position: ChrY:21408868..21408868
Ancestral: G
Derived: T
Reference: Judith Simon (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12380_F CGTCACACCCAGGTGTTG
Reverse Primer: A12380_R AGTCCAAGGCAATACTCCTGAAC
Reviews

Customers who bought this product also purchased
A12375
A12375
A12379
A12379
A12378
A12378
A12377
A12377
A12376
A12376
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L147.5
1 x FGC32513
1 x Y12619
1 x Y16925
1 x Y13618
1 x L396
1 x Y13894
1 x FGC9927
1 x Y12540
1 x SK1403
1 x Y12608
1 x HU216
1 x Y13690
1 x Y13624
1 x CTS900
$270.00
Haplogroup Info
Other products
Currencies