Top » Catalog » J2 » A12379

$18.00

A12379
[A12379]

A12379
hg38 Position: ChrY:15953253..15953253
Ancestral: C
Derived: T
Reference: Judith Simon (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12379_F ACAAGTCCACCCAGAACCTG
Reverse Primer: A12379_R ACCACAGATCAGTATTCATTTCC
Reviews

Customers who bought this product also purchased
A12377
A12377
A12376
A12376
A12375
A12375
A12380
A12380
A12378
A12378
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1751
$18.00
Haplogroup Info
Other products
Currencies