Top » Catalog » J2 » A12451

$18.00

A12451
[A12451]

A12451
hg38 Position: ChrY:12631603..12631603
Ancestral: A
Derived: G
Reference: Gary Dale Schrock (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12451_F CACAACCACCATGAGACACC
Reverse Primer: A12451_R AGGTGGATGGATCACCTGAG
Reviews

Customers who bought this product also purchased
A12450
A12450
A12449
A12449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17054
1 x Y9405
1 x A24024
1 x Y2163
1 x FGC19515
1 x FGC32611
1 x Y20567
1 x J2-BY268-Kessler Panel
1 x CTS6061
1 x A15503
1 x FGC17726
1 x FGC5929
1 x FGC61396
1 x A19115
1 x BY113818
1 x FGC29949
1 x Y994
1 x FGC16623
$487.00
Haplogroup Info
Other products
Currencies