Top » Catalog » J2 » FGC45318

$18.00

FGC45318
[FGC45318]

FGC45318
hg38 Position: ChrY:12586441..12586441
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC45318_F GTGGCTCACGCCTGTAATC
Reverse Primer: FGC45318_R AAATGAAGTCTTTTAGTTGAAATGC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
DNA Sample Kit
DNA Sample Kit
FGC45340
FGC45340
A12473
A12473
A12472
A12472
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY10613
1 x CTS6908
1 x PH1038
$54.00
Haplogroup Info
Other products
Currencies