Top » Catalog » J2 » A12499

$18.00

A12499
[A12499]

A12499
hg38 Position: ChrY:14656627..14656627
Ancestral: A
Derived: C
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12499_F GCTGGGCAGATTACTTGAGG
Reverse Primer: A12499_R TGCAATGTCCTAGTTTGGAGTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1244
1 x FGC30303
1 x Y15178
1 x FGC21085
1 x HU219
1 x Y18039
1 x Y5178
1 x Y14443
1 x SK1400
1 x Y13341
1 x SK1408
1 x FGC5940
1 x FGC16081
1 x A19157
1 x Y13133
1 x HU196
1 x FGC52112
1 x Y16959
1 x Y5168
1 x FGC32618
1 x HU222
$378.00
Haplogroup Info
Other products
Currencies