Top » Catalog » J2 » FGC50114

$18.00

FGC50114
[FGC50114]

FGC50114
hg38 Position: ChrY:7040416..7040416
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: FGC50114_F CTTTATGCTGCGCATTTGTC
Reverse Primer: FGC50114_R AATTCCCTGCATGGACACAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
1 x FGC34168
1 x A17943
1 x Y9399
1 x PAGES00028
1 x Y949
1 x PF7308
1 x Y13663
1 x A17906
1 x CTS1192
1 x L264
1 x Y23726
1 x FGC62432
1 x Y9013
$414.00
Haplogroup Info
Other products
Currencies