Top » Catalog » J2 » Y20306

$18.00

Y20306
[Y20306]

Y20306
hg38 Position: ChrY:7105982..7105982
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20306vl_F GGAAGAAGTAGGGGCTGGAC
Reverse Primer: Y20306vl_R TCCAGGTAAGTGGCCAAAG
Reviews

Customers who bought this product also purchased
Y20325
Y20325
FGC45340
FGC45340
Y20321
Y20321
Y20575
Y20575
Y20319
Y20319
Y20573
Y20573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies