Top » Catalog » J2 » Y20567

$18.00

Y20567
[Y20567]

Y20567
hg38 Position: ChrY:13244867..13244867
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20567_F CCATATGGACTGGGATACTCAAC
Reverse Primer: Y20567_R GCTCCAGGACCATTTGTTTC
Reviews

Customers who bought this product also purchased
Y20321
Y20321
FGC45340
FGC45340
Y20319
Y20319
Y20575
Y20575
Y20316
Y20316
Y20573
Y20573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7710
1 x SK1347
1 x Y13128
$54.00
Haplogroup Info
Other products
Currencies