Top » Catalog » J2 » Y20575

$18.00

Y20575
[Y20575]

Y20575
hg38 Position: ChrY:19198560..19198560
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20575v2_F GTTGCCTTGGCTGGACTG
Reverse Primer: Y20575v2_R CACAGCAGACAGCAAATATAGTGC
Reviews

Customers who bought this product also purchased
Y20567
Y20567
Y20306
Y20306
Y20554
Y20554
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Y20325
Y20325
Y20321
Y20321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
1 x Y23722
1 x FGC52116
1 x M67
1 x Y23095
1 x Y8497
1 x Y13647
1 x Y15238
1 x SK1342
1 x Y7708
$288.00
Haplogroup Info
Other products
Currencies