Top » Catalog » J2 » A12504

$18.00

A12504
[A12504]

A12504
hg38 Position: ChrY:21192487..21192487
Ancestral: A
Derived: G
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A12504_F CCCATCCATACCTAGCTCTCC
Reverse Primer: A12504_R TTGCCCAAGGAGTGAGATTG
Reviews

Customers who bought this product also purchased
A12503
A12503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19114
1 x A11525
$36.00
Haplogroup Info
Other products
Currencies