Top » Catalog » J2 » Y20566

$18.00

Y20566
[Y20566]

Y20566
hg38 Position: ChrY:13203985..13203985
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2 (not listed)
Comments: Below Y20307
Forward Primer: Y20566_F CAAGTCATAGGCACTGAAATTACC
Reverse Primer: Y20566_R GTCCCCAGCAAGCTGTTTAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
1 x Y15239
1 x FGC16088
1 x Y12907
1 x Y1008
$198.00
Haplogroup Info
Other products
Currencies