Top » Catalog » J2 » PF5191

$18.00

PF5191
[PF5191]

PF5191
hg38 Position: ChrY:15948964..15948964
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5191v2_F AGAGACTAGAACACATTATAGCTGATGTG
Reverse Primer: PF5191v2_R GCTTTGAGAAATATCTCCTTTCTTCC
Reviews

Customers who bought this product also purchased
FGC43418
FGC43418
FGC43428
FGC43428
FGC43437
FGC43437
FGC43425
FGC43425
FGC43435
FGC43435
FGC43424
FGC43424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15073
1 x A12472
1 x Y12600
1 x Y15202
1 x PH890
1 x CTS7683
1 x Y16930
1 x HU214
1 x A16337
1 x HU224
1 x Y7704
1 x FGC6745
1 x MF10488
1 x Y18824
1 x Y22466
1 x Y14364
1 x MF10508
1 x Y18397
1 x L558
1 x Y14405
1 x BY44673
1 x FGC5918
1 x Y15054
1 x Y16936
1 x Y12397
$450.00
Haplogroup Info
Other products
Currencies