Top » Catalog » J2 » A13164

$18.00

A13164
[A13164]

A13164
hg38 Position: ChrY:12662558..12662558
Ancestral: G
Derived: T
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A13164_F AATGCGCCATATTGAAGAGG
Reverse Primer: A13164_R GATGCCGCTACCTCTTTGTC
Reviews

Customers who bought this product also purchased
A13169
A13169
A13168
A13168
A13166
A13166
A13165
A13165
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16823
1 x Y3636
1 x L229
1 x Y12604
1 x B437
1 x SK1324
1 x A24015
1 x FGC20157
1 x BY32798
1 x FGC61400
1 x Y22076
1 x A25165
1 x Y13097
1 x A17063
1 x A16358
1 x PAGES00014
1 x Y25793
1 x FGC9961
1 x Y9404
1 x A19129
$360.00
Haplogroup Info
Other products
Currencies