Top » Catalog » J2 » A13168

$18.00

A13168
[A13168]

A13168
hg38 Position: ChrY:19045340..19045340
Ancestral: G
Derived: T
Reference: Timothy Schrag (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A13168_F AACCCTTCCCCTCTCCATC
Reverse Primer: A13168_R CAGCCACCCATCCACTTATC
Reviews

Customers who bought this product also purchased
A13164
A13164
A13169
A13169
A13166
A13166
A13165
A13165
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
$180.00
Haplogroup Info
Other products
Currencies