Top » Catalog » J2 » FGC36482

$18.00

FGC36482
[FGC36482]

FGC36482
hg38 Position: ChrY:7276142..7276142
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below Z7700 > L363 > FGC9966
Forward Primer: FGC36482_F GTGGAAATACAGCTCGGCAG
Reverse Primer: FGC36482_R GGTCCTGGTCTCCTGTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies